cell line expressing the human GIP receptor using primer ATTTAATTAAGGCGCGCCACCATG ACTA CCTCTCCGATCC as forward and AATTAATTAACTCGAGCT AGCAGTAACTTTCCAAC TCC as reverse primer. The PCR product was then cloned into pBP. The resulting construct was named pBPGIPR. VSV G pseudotyped retroviruses were made by cotransfection of pBP-GIPR with pVPack-GP and pVPack-VSV-G Vaccination against Obesity according to manufacturer’s instruction. 48 h after transfection supernatants were collected and added to CHOK1 cells. One day later cells were passaged under puromycin selection. Transduced cell populations were than cultivated under selective pressure. For binding assays, 16105 CHOK1-GIPR/well were seeded 2 days prior to binding GDC 0973 assays in 24 well plates in each well. Blocking assays were performed in a final volume of 500 ml. I125-GIP was incubated in the presence of the indicated amounts of purified total IgG form Qb-GIP or Qb immunized mice in binding buffer for 1 h at 4uC. This 23727046 solution was than added to adherent cells and the cells were incubated over night at 4uC. Cells were then washed with binding buffer, resuspended in 500 ml 0.1 M NaOH and transferred to 1.5 ml scintillation fluid and bound GIP determined with a b-counter. Statistical analysis For the analysis of body weight, blood glucose and fructosamine data two-way ANOVA were used. All other statistical analyses were made using a two-sided student’s t-test. Areas under the curve for the OGTT were determined using Prism Graphpad software. Supporting Information Body weight and body composition analysis Animals were weighed using a high precision scale. Body composition was determined by dual energy X-ray absorption scan at the ICS. Glucose and lipid homeostasis Total blood glucose, cholesterol, TGL, HDL, LDL, vLDL and FFA levels were measured after a 16 h fast. BGL were determined using a glucometer. Cholesterol, TGL and FFA levels were determined by enzymatic assays on an Olympus AU400 automated laboratory work station at the ICS. Lipid profiles were determined by F.P.L.C.. HbA1c levels were determined from whole blood using the A1cNow monitoring kit. For OGTT, mice were fasted for 16 h and then 2 g/kg body weight glucose in water was administered by oral gavage. BGL were determined at the indicated time points. For OLTT, mice were fasted for 16 h and then administered 8.35 ml/g olive oil by oral gavage. TGL levels were measured from whole blood using the CardioChek P.A. analyzer. Energy expenditure experiments Energy expenditure, activity and respiratory quotient were measured for 24 hours by using two opencircuit calorimetry systems.
Mice were allowed to adapt to the metabolic cages for 5 days. For measurements of oxygen consumption and carbon dioxide production, mice were placed in air-tight respiratory cages that were continuously ventilated with a flow rate of about 1 l/min. For each cage, air was sampled for 20 seconds at 2 min intervals. RQ was defined as VCO2 /VO2. RMR was calculated by taking the average of the 3 lowest VO2 readings in each experimental group during the light phase. Physical activity was determined by measuring beam breaks over a 24 h period. Physical activity was monitored by 3 8941386 arrays of 16 infrared light beam sensors and then converted into distance travelled in cm. Data were analyzed with AccuScan Integra ME software. Acknowledgments We thank Dr Paula Grest for histopathological evaluation of tissue samples and imaging and Dr. Jens Holst for providing a 3T3 c